Do all there’s no graded questions on here Transcribed Image Text: 3

Do all there’s no graded questions on here Transcribed Image Text: 3. Using the double stranded bacterial sequence provided below:
– Indicate the promoter sequence by underlining the TATAAT sequence and label the nontemplate (NT)
strand and the template strand (T)
– Identify the +1 transcription start site and label as +1 and draw a vertical line in the DNA sequence
between -1 and +1.
– Identify which strand of DNA will be transcribed and bold/circle the specific strand and specific
nucleotides that will be transcribed.
– Transcribe the appropriate part of the DNA into MRNA. Indicate the 5′ and 3′ ends of the new MRNA.
5′ GGCATTGCATAAAGTCGAGCATTATACGGCATTAGGATGGC
3′
3′ СCGTAACGTATTTCAGCTCGTAATАTGCCGTAATССТАССG
5′

-25-


Buy plagiarism free, original and professional custom paper online now at a cheaper price. Submit your order proudly with us



Essay Hope