What will be the amino acid sequence specified by the following gene?

What will be the amino acid sequence specified by the following gene?

3’ CAGGTACTTGCCAAATCGGTACATC5

Explain the method behind gel electrophoresis and how it works to separate DNA into fragments.

What is the pH of a buffer solution that is 0.20 M proprionic acid (HC3H4O2) and 0.1 M sodium proprionate (NaC3H4O2)? The KA of proprionic acid is 1.3 × 10−5.


Buy plagiarism free, original and professional custom paper online now at a cheaper price. Submit your order proudly with us



Essay Hope